circad | circRNAs associated with diseases

circ_AFF2
Gene	AFF2	Organism	Human
Genome Locus	chrX:147733520-147744289:n/a	Build	hg19
Disease	Hematopoiesis	ICD-10	n/a (n/a)
DBLink	Link to database	PMID	30124921
Experimental Method
Sample Type	Brain Tissues	Comparison	Temporal cortices were collected from 17 Temporal Lobe Epilepsy (TLE) patients and 17 non-TLE patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CATCCTCCAAACAAGTGAATCAC Reverse GGTTGGCAAGTGCATCAC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Nicolet, BP, Engels, S, Aglialoro, F, van den Akker, E, von Lindern, M, Wolkers, MC (2018). Circular RNA expression in human hematopoietic cells is widespread and cell-type specific. Nucleic Acids Res., 46, 16:8168-8180.